jasminestewart5142 jasminestewart5142

06-04-2024
Biology

contestada

Of the DNA sequences below, which would probably be the harder to determine?
a) CGATATATATATATACGATGGCATCACGAGCTGCATTCGCA
b) CGATATATATATATACGATGGCATCACGAGCTGCATTCGCA

Respuesta :

Otras preguntas

Find the simple interest on £3500 invested for 3 years at 4% per year

Suppose a large atom bonds with a small atom. Will the properties of the new molecule be the same as the large atom, the small atom, or different from both?

American policy toward France during Washington’s administration can best be described as an attempt to:

Under the Articles of Confederation, the power to declare war and negotiate peace rested with the

why are cells limited in size?

What is most likely to happen to an abandoned strip mine over time?

Solve for x.7/2x + 5 = x + 15/2/ is a fraction bar

Which New Deal programs were designed to limit people's losses from bank failures and stock market crashes?

A pond at a hotel holds 4290 gallons of water. The groundskeeper drains the pond at a rate of 78 ounce of water per hour. How long will it take take to drain

What notion of distance is needed to incorporate biological utility?