geek72 geek72
  • 10-03-2019
  • Mathematics
contestada

Math homework help !! 12 point d

Math homework help 12 point d class=

Respuesta :

gmany
gmany gmany
  • 10-03-2019

Answer:

c. ∠5 and ∠7

Step-by-step explanation:

Look at the picture.

Vertical angles are congruent.

On your picture:

∠1 and ∠3

∠2 and ∠4

∠5 and ∠7

∠6 and ∠8

Ver imagen gmany
Answer Link

Otras preguntas

Only answer if you know the real answer please appreciate it answer question number 2 please
I need the answer for this please ASAP i give you 30 points after you answer it correctly
Some fireworks are fired vertically into the air from the ground at an initial speed of 80 feet per second. The equation for this object's height h(t) at time t
ADC is a triangle AED and ABC are straight lines EB is parallel to DC Angle EBC = 148 Angle ADC = 63 Work out the size of angle EAB
What s an asteroid? 1. A rocky orbiting object. 2. A type of moon. 3. A dying star. 4. A very small, around planet.
In the telemarketing industry, one successful sale in one hundred calls is considered success. That is, the probability of success is 1/100 and the probability
What is the solution to the system of equations?
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
the number of ice creams you buy and their total cost are in​
Steve wanted to build a small racetrack for his remote-control car in his back yard. He used makeshift equipment to make a perfect circle for his racetrack. The