Iwritewithpencils Iwritewithpencils

14-05-2020
Biology

contestada

How do I use a codon wheel to solve this sequence of DNA?

AGTACCCGTTAATTAGTTGCCG

Respuesta :

andyk38105 andyk38105

14-05-2020

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

Answer Link

Otras preguntas

Carbon dioxide is a nonpolar molecule true of false

Why might an author choose to use words with a neutral connotation instead of words with a positive or negative connotation?

PLS HELP QUICK!!!!!!! Acting as a citizen from your assigned city-state, write a journal comparing the forms of government of the ancient Greek city-states. Ans

Which world war 2 general planned the D-day invasion of Nazi-held Normandy and later became president of the united states?

Why did president kennedy increase u.s troops in the vietnam?

Easy health question...

Pie charts without the amount of things?

explain the process of preparation of soil

How did the united states help the allies before getting into world war ii?

How to maintain a good balance in a horizontal relationship?