mrewo3862 mrewo3862

07-12-2020
Mathematics

contestada

If eighteen more than two times a number is negative ten, what is the number?

Respuesta :

azalloum30 azalloum30

07-12-2020

Answer:

-14

Step-by-step explanation:

so fitsy 18+2x=-10

-18 on both sides

2x=-28

divide by two

x=-14

Answer Link

Otras preguntas

Dr. Know-it-All hosts a TV talk show. One of his guests, Bill Collins, complains of his intense annoyance with people who talk on their cell phones while drivin

Renin is made by ________. granular cells of the juxtaglomerular apparatus the kidneys the nephrons All of the above.

White blood cells are also referred to as which of the following? platelets erythrocytes leukocytes megakaryocytes

You and a friend are riding your bikes to a restaurant that you think is east and that your friend thinks is north. You both leave from the same starting point,

Which of the following means "She has just arrived at school"? Ella acabo de llegar a la escuela. Ella acaba de salir de la escuela Ella acaba de llevar a la es

If the specific heat capacity of water is 4.18 J/g·oC , how much of heat energy is needed to raise the temperature of 10.00 g of liquid water from 14.1 oC to 16

A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is

The group of mental health professionals who earn either a Ph.D., Ed.D., or a Psy.D. and then diagnose and treat mild and severe mental and emotional problems a

ALBERTO Si yo pudiera formar parte de esta organización, (1) (estar) dispuesto (ready) a ayudar en todo lo posible. ELENA Sí, lo sé, pero tú no (2) (poder

The legal process by which a property owner challenges the real estate tax assessment on a given property in an attempt to reduce the property's assessment and