ashleygarcia090817 ashleygarcia090817

06-01-2021
Biology

contestada

write the code for RNA from this DNA STRAND :

AAAAAATTTTTTCCCGGGGTTTATATATC

Respuesta :

homadison4 homadison4

09-01-2021

Answer:

UUUUUUAAAAAAGGGCCCCAAAUAUAUAG

Explanation:

All you have to do is apply the same concept as DNA, but T (Thymine) is replaced with U (Uracil)

Answer Link

Otras preguntas

the radius of the dial of the worlds longestclock is 7.7find the area of the dial

And the last question is: The sum of two consecutive integers is at least 14. What is the least possible pair of integers? A) 4 and 5 B) g and 7 C) 7 and 8 D)

A central angle, thata, of a circle with radius 16 inches intercepts an arc of 19.36 inches. Find thata.

What precent of 14 is 4.34?

how do you write the cos 18° in terms of the sine.

Which inequality represents all the values of x for which the product below is defined?x[tex] \sqrt{x} -4 \sqrt{x} +1[/tex]A: x≥-1B: x≥4C:x≤4D:x≥0

what are the three particles of an atom

Find the roots of each polynomial equation X^3-2^2+5x-10=0.

Find the volume of a sphere with a radius of 5m. Remember that the volume of a sphere is 4/3pir^3

How is the road like cytoplasm??