bigdoja bigdoja

07-05-2021
Mathematics

contestada

What is the volume of a rectangular prism with the dimensions, base
12
cm, height em, and length
cm

What is the volume of a rectangular prism with the dimensions base 12 cm height em and length cm class=

Respuesta :

07-05-2021

volume is length x width x height
2/3 x 1/2 x 3/4
= 2/6 x 3/4
= 6/24
reduced is 1/4 cm^3

Answer Link

Otras preguntas

What group declared war on Ghana?

There is 83 bags and there was 27 apples how many apples are in each bag

Nine students choose integers. Seven of them are: -16, 12, -13, -6, -5, 6 and 1. When all nine integers are ordered from least to greatest, the middle integer i

Avery gets newsletters by e-mail. He gets one for sports every 5 days,one for model railroads every 10 days tone for music every 8 days. If he got all three tod

5 x 10 ^3 + 4.3 x 10^4=

PLEASE HURRY WILL MARK BRAINLIEST What is the equation in point slope from the line that passes through the point (-8,5) and has a slope of 2?

Molecules can be made of atoms of__? -the same element only. -different elements only. -the same or different elements.

Why are some cells in interphase longer than others?

What is the complementary DNA strand for the following sequence: ATGGCTTGCCAAGGTCCGGAAACTTTG

What is the probability of drawing a red card, not replacing it, and then drawing another red card?