raewolfe01 raewolfe01

13-12-2021
Mathematics

contestada

State the y-coordinate of the yintercept for the function below.
f(x) = 4x^3-12x^2-x+15

Respuesta :

ajaynvsa1 ajaynvsa1

13-12-2021

Answer:

15

Step-by-step explanation:

let y = f(x)

substitute x = 0

y = 4(0)^3-12(0)^2-(0)+15 = 15

Answer Link

Otras preguntas

The mathematical theory that explores the consequences of making the allocation of units to treatments by means of some random mechanism such as tables of rando

Scott discusses how the general manager runs the store, and is responsible for the operations and for the performance of the restaurant overall. This is an exam

Is there a difference between the Middle Ages and the Medieval time? Explain.

The human resources department of Orbit Bank believes in being unbiased toward all employees and treating them fairly. They believe it is crucial that the compa

In an Asian country with a population of 6 million people, 60,000 deaths occurred during the year ending December 31, 2009. These included 30,000 deaths from ch

What is the maximum number of amino acids in a peptide that would be produced from the following mRNA sequence: 5′ AAUCCGUAAAUGAGACCGUCGAUCAAUUAGCG 3′?

Savannas experience warm temperatures, low levels of precipitation, and have an abundance of grasses and shrubs. What events often occur because of these condit

When signing a voter declaration on a voting registration form, voters are certifying all of the following things EXCEPT?

The specialty in primatology that takes into consideration the welfare not just of primates but also of the ecosystems and human communities with which they are

A(n) ________ is a carefully predetermined cost that is usually expressed on a per unit basis. A. applied cost B. standard cost C. flexible cost D. allocated co